Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_358D12-3
Clone ID CMHD-GT_358D12-3
Vector pGepNMDi3
Project cmhd

Sequence tag CMHD-GT_358D12-3
Sequence
AAAGAACAGACCTTGCCTTTGGACTTCATAGAACACTTTCTGGCCCTGGATGGACTCCAGGAAGCACGGGACCTGTGCCA
GGCCCATGGACTGACCTTGGATAAAGACAGAGTTGTATTCCTGAGGGGTCAATACTCTGAGGAAGGACTCCCACCCCCTG
GTGCCTACCACATATTAGTGGGGAATAAGTTGCAGGGACACACCCTGGAAGATGTGGTCATGGCTGAGGAAGGTGACATT
CACAGACCTGGCTCTGCAGCTTGAGAGGGTCTCGTCTCCCACAAGGCCTGGGTCAGAGCACCTGGCTTCTTTTTCATAAT
TCCCAAACAATAAAAGGAACTCATTATGATCTCCAAAC
Sequence Type mRNA
Unitrap ID UNI13053

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6116000..6116357 354
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024790 (Sac3d1) NM_133678 SAC3 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1913656]

 
Come back to gene ENSMUSG00000024790


For any suggestions or comments, please send an email to unitrap@crg.es