Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14948G12
Clone ID IST14948G12
Vector VICTR76
Project tigm

Sequence tag IST14948G12HMF2
Sequence
GAGTTAGCAATCTGCCCTTTAAATTCACAGGACCCTGCTCCTCTTTGCAAGAGTCACTGTCCAAGCCTACATAACAATCC
TGGGGCCCCTTGGGTATCAGTCCAGCTGTCTGTCAAAGGATAGGTGACATGGGGAGCCAAAGCCAGATGCATCATATGGT
CCCCAGTCCCTGCTCTGTCTCTTACAGCTGTGCAGCCTTGGCACATGGACTTAAGCTCTCTGGGCCTGACTCTATCAGCA
GTATGAGGATAAGAAAGACAGATGGAAGCCGGGCATAGTGGCGCACGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAG
GCAGCTTTCTGAGTTCNAGGCCAGCCTGGTCTACAAAGTGAGTTCCNGGACAGCCNAGGCTACNCANAGAAACCCTGTCT
CAAAAAAACANCANCNACNAAAGAAAGAAAGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 153343261..153343692 410
NO GENE  


Sequence tag IST14948G12HMR1
Sequence
CTCTAGGTCACATTGTTGCTCCACATCAGCCCAGTGGGGGAAGGTGGTACCAGCTCTAAGGGGAGGAGGCTCTGTCCTTT
ACAGTGGTGTGGCAGAAGGAGATGCAATTTCAGTCTAGTCACTGGGCTGCCTGCAGCTCCAAGAGGAGACCCATATGGTC
TGGATGGTACAGGAGCTCAGGGTGGGGGAGAGGGTGCCATGGAGTAAGGGAGGGATCACGGGAAATTGTTGTGANCCTCT
GATTCTGGAACTGGGGAANGANGNGCTGNNNTTN
Sequence Type genomic DNA
Unitrap ID UNI20766

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 153342996..153343263 258
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061411 (8430427H17Rik) NP_001127772 RIKEN cDNA 8430427H17 gene Gene [Source:MGI Symbol;Acc:MGI:1918765]


Sequence tag IST14948G12BBF1
Sequence
ATGTCTCCAGCTTGAGTTTTGTTTTGTTTTTTGTTTTTGTTTGTTTGTTTGTTTTTCNAGACAGGGTTTCTCTGTGTAGC
CCTGACTGTCCTANAACTCACTTTGTANACCANGCTGGCCTCNNACTCANAAATCTGCCTGCCTTTGCCTCCCAAGTACT
GNNNNNAAANNTGTGGGCCACCANTGCTNTNCTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000061411


For any suggestions or comments, please send an email to unitrap@crg.es