Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11556B9
Clone ID IST11556B9
Vector VICTR76
Project tigm

Sequence tag IST11556B9HMF1
Sequence
TAAGCCAAAGGCTTCATTAAACTATGCTTATCTGTACTGTGTGCAACGGTTACTTTTTCTAGTCTTTTCGCACTATATAT
TCTAATCTTTTCAAAATTTTCAGCAATGACCCATCAAAGGAATTCTAATGCNTGTTTGGTCCTGGAAAAACACTGGTAGA
AGGCCTATCATCCTANCANTCNNTCAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96619201..96619388 178
NO GENE  


Sequence tag IST11556B9HMR1
Sequence
TGGGGATTTTGCACCCAAATCAGACTGGGTTTGTGCTGATGTTC
Sequence Type genomic DNA
Unitrap ID UNI20682

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 96619087..96619129 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040433 (Zbtb38) NM_175537 zinc finger and BTB domain containing 38 Gene [Source:MGI Symbol;Acc:MGI:2442866]

 
Come back to gene ENSMUSG00000040433


For any suggestions or comments, please send an email to unitrap@crg.es