Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12270B10
Clone ID IST12270B10
Vector VICTR76
Project tigm

Sequence tag IST12270B10BBF1
Sequence
AAATAAATTAAGTTTTTGAACTGCTCACCAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI18577

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 27178001..27178036 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037234 (Hook3) NM_207659 hook homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2443554]

 
Come back to gene ENSMUSG00000037234


For any suggestions or comments, please send an email to unitrap@crg.es