Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14260H6
Clone ID IST14260H6
Vector VICTR74
Project tigm

Sequence tag IST14260H6HMR1
Sequence
CCTTTCAACCNTAGCTGTGACCCACTTTCTCCAGGCTGTGTAAAGACTACATCTCCCTGGCTTCTGGGCTCTGGGAATTC
TTCCTTCTTAGTCTTCTAAATGTTGGGACTANNNGTACNCNCCANANCTTCATGCCACCAACCCAGATGTTGCTTGTTTT
CCCACTGANCCTCCATTTCTTCACAATAAGTACTCATCTAACTTACATTATTTTTACTATATGTCTTCCCCAGGAAGCAG
GAACCATATTTACAGCATTCCACTTACCAGTCAATCTCCAACCCCATGTACGGTACTGAATGCCTANTANATGCTCAATA
AATGTCCTGAGTTAAAAGACTATCTGGAAGGGTGGAAAGCTGGCTCAAAGGTTAAAAGTACTGATTGCCACTGGGCANTG
GTGGCGCACACCTTTAATCCCAGCACTTGGGANGCANANGCAGGCGGATTTCTGAGTTCNANGCCAGCCTGGTCTACAGA
GTGAGTTCCANGACAGCCNNGGCTACACAGAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4898061..4898574 474
 
EST/CDNA Est Name
  CF747624.1 - BE531636.1


Sequence tag IST14260H6BBF1
Sequence
AAGGCAGAAATTAGCCCCTCTGTTTGGAAAANGANAAACTAAGGAAAGATCNNAAAACTGATGGGCCTTCCTTTGCTGAT
AACCAGTAAACTTTCCAAGTCCAATAACACTGGCTAGACCACTCTAAGGTAAATGCATTCAGAACTCTGGATTCCCAGGA
CATTTGTCACCATAGTGAAGGGCAGGAGACAGTAGGTAAACAAGCCTGGTCACACGTCTTCTGAGTGGTAGGTGGAGAAG
TGATCTCACCATTTGCTCAGGACCAGGCAGGCTCTTGGGTTCATCTAGGGGGGGCTAAGACGGGATGGGTCANCCAGGGA
GCTAGATGCAANACCTCTGTGGGCTGAGGGATCATGTCTTTATTCCNCAGAGACTCCNAACACCCCAAGTACTGCATCGA
GTTGAGTGCCCAGCCANTGNGGCTGGTCCGGGTACACNANGTCCTGNTN
Sequence Type genomic DNA
Unitrap ID UNI30563

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4897619..4898064 422
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006464 (Bbs1) NM_001033128 Bardet-Biedl syndrome 1 (human) Gene [Source:MGI Symbol;Acc:MGI:1277215]


Sequence tag IST14260H6HMF1
Sequence
AAGGCAGAAATTAGCCCCTCTGTTTGGAAAAGGAGAAACTAAGGAAAGATCAGAAAACTGATGGGCCTTCCTTTGCTGAT
AACCAGTAAACTTTCCAAGTCCAATAACACTGGCTAGACCACTCTAAGGTAAATGCATTCAGAACTCTGGATTCCCAGGA
CATTTGTCACCATAGTGAAGGGCAGGAGACAGTAGGTAAACAAGCCTGGTCACACGTCTTCTGAGTGGTAGGTGGAGAAG
TGATCTCACCATTTGCTCAGGACCAGGCAGGCTCTTGGGTTCATCTAGGGGGGGCTAAGACGGGATGGGTCANCCAGGGA
GCTAGATGCAAGACCTCTGTGGGCTGAGGGATCATGTCTTTATTCCNCAGAGACTCCNAACACCCCAAGTNCTGCATCNA
GTTGAGTGCCCAGCCNGTGGGGCTGGTCCGGGTACACAANGTCCNNNTNNTN
Sequence Type genomic DNA
Unitrap ID UNI30563

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4897621..4898064 430
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006464 (Bbs1) NM_001033128 Bardet-Biedl syndrome 1 (human) Gene [Source:MGI Symbol;Acc:MGI:1277215]

 
Come back to gene ENSMUSG00000006464


For any suggestions or comments, please send an email to unitrap@crg.es