Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_337G4-3
Clone ID CMHD-GT_337G4-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_337G4-3
Sequence
ACCTCACCACCTCCAAACAAAAACCCACACAAGGAGAGGTATTTTGACGGAGTCGATGAGAACAACCAAGAATATTTGCG
GGAGAGGAACATGGCACCAGACCTTCGTCAGGACTTCAATATGATGGAGCAGAAGAAGAGGGTGTCTATGATTCTACAGA
GTCCTGCCTTCTGAGAAGAGCTGGAGTCTATGATACAGGAACAGTTTAAGAAGGGCGAGATCCCCACAGGGCTGCTGGCA
TTGCAGCAAATTGCAGATTTCATGACTGCGAGTGTACCAAATGACAACCCGGTAGCTCCACAAGGAGGAATGGCCGCCCT
GAACAAGATTCTTGGTATGGTCACTCCTGAGAATGACCTTAGAGGGTCGGATTCTATCACATATGACAAAGGGGAGAAGT
TACTGCGGTGAAAACTGGCAGCATTTTACAGACTGGCAGATCTCTTTGGCTGGACCCAGCTTATCTACAATCATATCGCA
ACCAGAGTGAACTCTGACCAGGAACACTTCCTCATCGAACCTTTTGGACTTCTCTACAGTGAAGTGACTGCATCCAGCT
Sequence Type mRNA
Unitrap ID UNI13065

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34944023..34952919 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029106 (Add1) NM_013457 adducin 1 (alpha) Gene [Source:MGI (curated);Acc:Add1-002]

 
Come back to gene ENSMUSG00000029106


For any suggestions or comments, please send an email to unitrap@crg.es