Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_344H8-3
Clone ID CMHD-GT_344H8-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_344H8-3
Sequence
TGAATGAGGACCTGGAGAAAGTCAAGAACTGGAAGAAGGATGCCTATCACAAGCAGATCATGGGTGGCTTCAAGGAGACG
AAAGAGGCCGAGGATGGCTTCCGAAAGGCCCAGAAGCCCTGGGCTAAAAAGATGAAGGAGCTAGAGGCGGCCAAGAAGGC
CTATCACTTGGCTTGTAAGGAGGAAAGGCTGGCCATGACCCGGGAGATGAACAGTAAGACAGAGCAGTCGGTCACCCCTG
AACAGCAGAAGAAACTTGTGGACAAAGTGGACAAATGCAGACAGGATGTGCAAAAGACTCAGGAGAAGTATGAGAAGGTG
CTGGAAGATGTGGGCAAGACCACACCACAGTACATGGAGGGCATGGAGCAGGTGTTTGAGCAGCGCCAGCAGTTTGAGGA
GAAACGGCTGGTCTTCCTGAAGGAAGTCCTGCTGTATATCAAACGGCATCTCAACCTAACGGAGAACAGCAGCTACATGC
ATGTCTACCGAGAACTGGAGCAGGCCATCCGGGGGGCCGATGCCCAGGAGGACCTC
Sequence Type mRNA
Unitrap ID UNI13070

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27841886..27844002 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040276 (Pacsin1) NM_011861 protein kinase C and casein kinase substrate in neurons 1 Gene [Source:MGI (curated);Acc:Pacsin1-001]

 
Come back to gene ENSMUSG00000040276


For any suggestions or comments, please send an email to unitrap@crg.es