Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_344A4-3
Clone ID CMHD-GT_344A4-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_344A4-3
Sequence
GCAGGTGCTTAGAAGGAAGATCCTGCTACCATGTCCCTGCTGCAGAGGAGCCTGGATCCCGAGAAGACCCTAGGTCTGGT
GGATGTGCTTTACACAGCCGTGCTAGACCTAAACCGCTGGAGAACAGGGAGGGAACAAGCTTTACCCTGTATACAGATCC
AGCTGCAAAGGGATATCTGCGATTTTGGGAATCAGGCTGACCTGCCTTCTGGAAATGGAAGCAAATCCTCGGGACTGCAG
AAGACTTTCTCCAAACTGACATCCCGGTTCACAAAGAAAGTGTCATGCACCAACTCTGGCAGCACACACTATTCCAAAAA
CATCTTCAC
Sequence Type mRNA
Unitrap ID UNI13071

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 35030800..35033253 200
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066571 (4931406P16Rik) NM_172741 RIKEN cDNA 4931406P16 gene Gene [Source:MGI Symbol;Acc:MGI:1924311]

 
Come back to gene ENSMUSG00000066571


For any suggestions or comments, please send an email to unitrap@crg.es