Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_343A8-3
Clone ID CMHD-GT_343A8-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_343A8-3
Sequence
GAGCCACATGGGAGTGGTGAAATGGTCTGTACAATATGTCAAGAAGAGTATTCAGAAGCTCCCAATGAAATGGTTATATG
TGATAAGTGTGGTCAAGGATATCATCAGCTGTGTCACACACCTCATATTGACTCGAGTGTGATTGATTCAGATGAAAAGT
GGCTTTGTCGACAGTGCGTTTTTGCAACAACTACAAAGAGGGGTGGTGCGCTTAAGAAAGGACCAAATGCCAAAGCATTG
CAAGTCATGAAGCAGACATTACCCTATAGTGTGGCTGACCTTGAATGGGATGCAGGCCATAAAACCAATGTCCAGCAGTG
CTACTGCTATTGTGGAGGCCCTGGAGACTGGTATTTAAAGATGCTGCAGTGCTGCAAATGTAAGCAGTGGTTTCATGAAG
CTTGTGTCCAATGCCTTCAGAAGCCAATGCTGTTTGGAGATAGGTTTTATACATTTATTTGCTCTGTCTGCAGTTCTGGA
CCAGAATACCTCAAACGTCTACCGTTACAGTGGGTAGATATAGCACACCTATGCCTTTACAACCTAAGTGTTATTCACAA
GAAGAAATACTTTGATTCTGAACTTGAGCTTATGACATACATTAATGAAAACTGGGATAGATTGCACCCTGGAGAGCTGG
CAGACACACCCAAATCTGAAAGATATGAGCATGTTCTGGAGGCATTAAATGATTACAAGACCATGTTTATGTCTG
Sequence Type mRNA
Unitrap ID UNI13073

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108516018..108528207 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]

 
Come back to gene ENSMUSG00000029267


For any suggestions or comments, please send an email to unitrap@crg.es