Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12821H12
Clone ID IST12821H12
Vector VICTR76
Project tigm

Sequence tag IST12821H12HMR1
Sequence
CATCCATGATGTGGGCTGACACCTCTTCCCTCATCTCTGGGGCAGTCTCTGTTGGTTGGGGAGTGGGGAGTCCNTATGAT
CCCC
Sequence Type genomic DNA
Unitrap ID UNI20978

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104179856..104179938 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]


Sequence tag IST12821H12HMF1
Sequence
GATGCACTGTCTTCAACCCCATTTCCAATATCTACGGGGCTTCTAGGAACACATACATGGTACCATGGGGACCCAGCTAC
TCANANAAGGGCCAGCTGGAACGGGTTGCTCTCCCTACTTTGCTGGGCCATCCATGGAACAGGGAGGGGAGTCTGGGGAC
AGCAGACACTGTGGGGACACAGGAGGTCCTGAGCCCTAGATGATTTATTCTATGCAATGTCTCACAAGGACACACTCATG
ACACTTGTTACAGCAAAGGCTGCAGCACACCTCATGGAGACTGCGACAGTACTCACACTGCCTCCACCCGGGACGTGTTT
GATATTATCCTTCGAGCCNCACTTGGACTGGACGTTGCTAAGATCCAGCTTCTTATTAATTATCTGCACCTTTGATAGCC
NAAAAAAAGAGTGAGAGACAACCNCACCGGANCATCGCCCCCTGANCTGTTGGGCTGTGGGGGGANANCCNGGTCTGANC
CCTGACTCCTCNGGGGCTCANAANCTGCCTGGGATGGCACCCNGGAAGTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104179329..104179859 497
 
EST/CDNA Est Name
  CO434018.1 - CD802644.1 - BM937987.1 - C77305.1 - CD776837.1 - BE860535.1 - BG066372.2

 
Come back to gene CO434018.1 - CD802644.1 - BM937987.1 - C77305.1 - CD776837.1 - BE860535.1 - BG066372.2


For any suggestions or comments, please send an email to unitrap@crg.es