Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BB0129
Clone ID BB0129
Vector pGT2lxr
Project sanger

Sequence tag BB0129
Sequence
GTTGTGAGNCTTTCTAGATGGTTTTTAGTTCCCTGAAGCAGCCGTTTAACCCCAACCCTGGACCCTTCCGAGTTTAAGCC
CACCCCACTCCGGGTGCCCCGGACCTTAGGGTTCAGGAGGGGTGAGTCAGAATTCAGCCGACTTTACCATGGCGGCTACC
GATCACCG
Sequence Type mRNA
Unitrap ID UNI1998

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 32143117..32143505 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044627 (2900010J23Rik) NP_780399 RIKEN cDNA 2900010J23 gene Gene [Source:MGI Symbol;Acc:MGI:1920181]

 
Come back to gene ENSMUSG00000044627


For any suggestions or comments, please send an email to unitrap@crg.es