Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_344A8-3
Clone ID CMHD-GT_344A8-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_344A8-3
Sequence
GGTGAGGTGGCTTTGACCCCGGGTGGCCCGGCCAGCGCGACCGAGGAGGTGGCTGGACAGCTGGAGAATGAACGGAGAAG
CGGACTGTCCCACAGACCTGGAAATGGCCGCCCCCAAAGGCCAAGACCGCTGGTCCCAGGAAGATATGCTGACTCTGCTG
GAATGCATGAAGAACAACCTCCCATCCAACGACAGCTCCAAGTTCAAAACCACAGAGTCGCACATGGATTGGGAAAAAGT
TGCGTTTAAGGATTTTTCAGGAGATATGTGCAAGCTCAAATGGGTGGAGATTTCTAACGAGGTAAGGAAGTTCCGTACAT
TGACAGAATTGATCCTCGATGCTCAGGAACATGTTAAAAACCCTTACAAAGGC
Sequence Type mRNA
Unitrap ID UNI13077

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 102175465..102177787 183
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020923 (Ubtf) NM_001044383 upstream binding transcription factor, RNA polymerase I Gene [Source:MGI (curated);Acc:Ubtf-002]

 
Come back to gene ENSMUSG00000020923


For any suggestions or comments, please send an email to unitrap@crg.es