Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_342C6-3
Clone ID CMHD-GT_342C6-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_342C6-3
Sequence
CCAACATCCGCATCATGAGAAGCAAGAAGGATGCACCTGTGGACCAGCTAGGCGCCGAGCACTGCTATGATGCAAGTGCC
CCCCCGAAGGTGAGGAGGTACCAGGTACTCCTGTCGCTGATGCTCTCCAGCCAGACCAAAGACCAGGTCACAGCAGGTGC
CATGCAACGGCTCCGGGCCCGGGGCTTGACTGTGGAGAGCATCCTGCAGACCGATGATGACACGCTAGGCAGACTCATCT
ACCCTGTGGGCTTCTGGAGGAACAAGGTAAAATACATCAAGCAGACAACCGCCATCCTGCAGCAGCGCTACGAAGGGGAC
ATCCCTGCTTCCGTGGCTGAGCTGGTAGCCTTGCCAGGTGTTGGGCCCAAGATGGCACACTTGGCTATGGCTGTGGCCTG
GGGGACCATATCAGGCATAGCAGTGGACACACATGTGCACAGAATAGCCAACAGACTGAGGTGGACCAAGAAGATGACCA
AGACCCCAGAAGAGACACGCAAGAACTTGGAAGAGTGGCTACCCAGGGTGCTGTGGAGTGAGGTCAACGGACTACTGGTA
GGCTTCGGCCAACAGATCTGTCTTCCTGTCCATCCTCGATGTCAGGCTTGCCTC
Sequence Type mRNA
Unitrap ID UNI13079

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24771022..24775640 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041429 (Nthl1) NM_008743 nth (endonuclease III)-like 1 (E.coli) Gene [Source:MGI Symbol;Acc:MGI:1313275]

 
Come back to gene ENSMUSG00000041429


For any suggestions or comments, please send an email to unitrap@crg.es