Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12071C1
Clone ID IST12071C1
Vector VICTR76
Project tigm

Sequence tag IST12071C1BBF1
Sequence
ACTGTAGCTGTCTTCAGACACTCCAGAAGAGGGCATCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI326 UNI10046 UNI32331 UNI32332 UNI32333 UNI32334

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166452: 18201..18243 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165754: 306801..306843 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056050 (Mia3) NP_796363 melanoma inhibitory activity 3 Gene [Source:MGI Symbol;Acc:MGI:2443183]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4310217..4310259 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 21079794..21079836 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 13813150..13813192 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 10272008..10272050 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 12803780..12803822 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022191 (Rnasen) NP_001123621 ribonuclease III, nuclear Gene [Source:MGI (curated);Acc:Rnasen-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 14693891..14693933 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 4579233..4579275 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20095526..20095568 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 6069483..6069525 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 20611466..20611508 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021806 (Nid2) NM_008695 nidogen 2 Gene [Source:MGI Symbol;Acc:MGI:1298229]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 5900959..5901001 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 9954940..9954982 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 5005595..5005637 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032827 (Ppp1r9a) NM_181595 protein phosphatase 1, regulatory (inhibitor) subunit 9A Gene [Source:MGI Symbol;Acc:MGI:2442401]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 5848984..5849026 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 4068285..4068327 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040407 (Akap9) NM_194462 A kinase (PRKA) anchor protein (yotiao) 9 Gene [Source:MGI (curated);Acc:Akap9-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 28373801..28373843 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 16067441..16067483 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7792846..7792888 43
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 5907691..5907733 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043241 (Upf2) NM_001081132 UPF2 regulator of nonsense transcripts homolog (yeast) Gene [Source:MGI (curated);Acc:Upf2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 33942206..33942248 43
NO GENE  


Sequence tag IST12071C1HMF2
Sequence
CTGTTACTGCAAGGTGTCCTTAGGCTGTGGAAAAAACAGGGATGAGGAGGAACGACTTCCAGCTCCTATTTTAGCCACAA
GTCGTGGTGTTACTAATGACATAATTCTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 129988920..129989028 109
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 8363639..8363747 109
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 154926265..154926373 109
NO GENE  

 
Come back to gene ENSMUSG00000043241


For any suggestions or comments, please send an email to unitrap@crg.es