Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12416D6
Clone ID IST12416D6
Vector VICTR76
Project tigm

Sequence tag IST12416D6BBF1
Sequence
TAAGTTTGGGGAGGAAACTGGAACATGTGGCCTTCATCAGGAAGGGACTGGGTGGGCTCTCTCCTCGTCTAGCATTCAGT
GTCTGGACCTGTTTCTTCTTTGGAAGGGTGGCCACTGCCAGAATCAGTATCAGGCTGTAGATGTGGTTCCCCCAGTCCTC
GCCTGCTTGCCAGCCTTAACTGCAGCTGATGACTCCCTGGAGGCTAGTACGCTGTCTGTCCGGTTCTCTGAAGCCCGACG
CCTTGCCAGGTTGCCCAGAGGTGACTCACTTGGACCTTGCAGACAGATAGAACCAGCTCTCTTGAGTTCTTCTGTCTAGG
TTAGAAGAGGCCTGAGATGGGGGTTTGGATGTAGTTTCCCCACTTACATACAGTGGAGATAGTGCTTATCATCTGGACCC
AGTTAGAGATGAATAGGCCAGGATTCAGATAAGTGTGAAGTCTGTACATCTGCNAAATTGAATGTGCATTTTTCTCTTTT
TCCTTTTGNTGGGGGGGTGGGGCTGGGGGGGGGGN
Sequence Type genomic DNA
Unitrap ID UNI2404

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 111233370..111233883 510
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029512 (Ulk1) NM_009469 Unc-51 like kinase 1 (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1270126]


Sequence tag IST12416D6HMF1
Sequence
TAAGTTTGGGGAGGAAACTGGAACATGTGGCCTTCATCAGGAAGGGACTGGGTGGGCTCTCTCCTCGTCTAGCATTCAGT
GTCTGGACCTGTTTCTTCTTTGGAAGGGTGGA
Sequence Type genomic DNA
Unitrap ID UNI2404

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 111233773..111233883 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029512 (Ulk1) NM_009469 Unc-51 like kinase 1 (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1270126]

 
Come back to gene ENSMUSG00000029512


For any suggestions or comments, please send an email to unitrap@crg.es