Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_342E11-3
Clone ID CMHD-GT_342E11-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_342E11-3
Sequence
CCTCTTCAGTCTGTCAAGTTGAACCTGTGGGAAGATGGTTTGAAGCTTTTGTTAAGAGGAGAAACAGAAATGCTTCTACA
TCTTTTCAGGAACTGGAAGATAAGAAAGAGTTGTCAGAGGAATCAGAAGATGAAGAGTTACAGTTAGAAGAATTCCCCAT
GCTGAAAACACTTGATCCCAAAGATTGGAAGAATCAAGATCATTATGCGGTTCTTGGACTTGGCCACGTCAGATACACAG
CTACACAGAGACAGATCAAAGCAGCTCATAAAGCAATGGTCTTGAAACATCATCCAGACAAACGGAAAGCGGCTGGGGAA
CCCATCAAAGAAGGAGACAATGACTACTTCACTTGCATAACTAAAGCTTATGAAATGTTGTCTGATCCAGTGAAAAGGCG
GGCATTTAACAGTGTAGATCCTACTTTTGACAACTCAGTTCCTTCTAAAAGTGAAGCTAAGGACAATTTTTTTCAAGTGT
TTTCTCCAGTGTTTGAAAGGAATTCAAGATGGTCAAATAAAAAAAATGTTCCCAAGCTTGGTGATATGAACTCCTCGTTT
GAAGATGTAGATGCGTTTTACTCTTTCTGGTATAATTTTGATTCTTGGAGAGAATTTTCTTATTTAGATGAAGAAGAAAA
AGAAAAAGCAGAATGCCGTGATGAGAGGAAGTGGATTGAAAAGCAGAACAGAGCCACGAGGGCACAAAGGAAAAAGGA
Sequence Type mRNA
Unitrap ID UNI13088

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 21274493..21289055 191
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029014 (Dnajc2) NM_009584 DnaJ (Hsp40) homolog, subfamily C, member 2 Gene [Source:MGI (curated);Acc:Dnajc2-006]

 
Come back to gene ENSMUSG00000029014


For any suggestions or comments, please send an email to unitrap@crg.es