Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_337G7-3
Clone ID CMHD-GT_337G7-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_337G7-3
Sequence
ACACCATGGAGACGGTGCTGGTCCTCTGCAGCTTGCTGGCCCCTGTGGTCCTGGCGAGTGCTGATAAGAAGAAAAAAAAA
AATCATTTCTATTACGACTACCACACACTGAGGATTGGGGGGGTGGTGTTTGCTGTGGTCCTCTTCTCCGTTGGGATACT
TCTCATCCTCAGTCGCAGATGCTGGTGCAGTTTCTATCATAAGCCCAGGGCTCCTGGTGACGAAGAGGACCACGTGGAGA
ACCTCATCACTACAAACGCTGCGGAGCCCCAGAAGGAAGAAAACTGATGTGCAGCCTCCACCGTGAAGCCTCCACAAGAC
AAGGCCGGCTACTTGATGCTTCTTAGAATGATGTCGAGGCTTGATAAAACCGGCTACTTCTTACCACACCTTTCCCTAGG
AAAAGCCAAGAATGCGTGTTCCCTGTGCCTCTCCCTGCCCCCCACTAACCCCAGTCGTATATTATTGATGCAACACTTCT
CACTGCAGCTGGAGTCTGGACCCTGTCTGTGCCGTGTCTGTGCCGTGTCTGTGTGGGTCTGCTGATTGTGGTCGACCGTG
GATTTCTTTGTTTCTGTGAACTGTGTGCTTCTTCTCCCACGCTGCCGTCGGCGCCTTGTGGCCTCCTGTGACCTCCTCCT
CCTCTTGTTCTCTGGAGGCTGCTCTGTTCCT
Sequence Type mRNA
Unitrap ID UNI13089

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 45198071..45203319 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066705 (Fxyd6) NM_022004 FXYD domain-containing ion transport regulator 6 Gene [Source:MGI Symbol;Acc:MGI:1890226]

 
Come back to gene ENSMUSG00000066705


For any suggestions or comments, please send an email to unitrap@crg.es