Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14711D2
Clone ID IST14711D2
Vector VICTR76
Project tigm

Sequence tag IST14711D2HMR1
Sequence
CGTGATTCCCAGGGCATCCCCCACCATGCTATAGATTGAGTGTGATGATGGAGAAGGAAGCCTCACAGCTTATAAACACT
CATCTGAAT
Sequence Type genomic DNA
Unitrap ID UNI27131

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104152995..104153083 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]


Sequence tag IST14711D2HMF1
Sequence
ACGTATGCTAAACCAGGCAGTCCACCAACTAAGTGAGCTGTGTCCTGGCCTTTGTGGCCTGTTTTGAGACCAGAAAGACT
ATAAAGCATTTCTGATTACCCAGGAGTGGTGGGAAAGTCTACAGCTTTCATCCTAAACGGAGGACAAACTTCTTCAATGA
CAAAACTTTGATGTAGAGATATGGCTTAGTGGCTAAGAGCACAGACTGCTCATGCAGAGGTCCTGAGTTCAATTCCCAGC
CCCCACATGGTGGCTCATGACCATCTGTAATGGGATCTGATTCTCTTTTCTGGTGTGTCTGAAGTCGGTGACAGTGTACT
CACATACATAAAATAAATGAATCTAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104152645..104152997 353
NO GENE  

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es