Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14651B1
Clone ID IST14651B1
Vector VICTR74
Project tigm

Sequence tag IST14651B1HMF1
Sequence
CCCTCTTATATCCCACTCATATGAAGTATCTCCACACTACTCAACTTCGTTCTAGCTGAGCACAAATTGCATCAACCAAG
GAGGCTAGAGGGAATCGGAGACACCACCCTACACAAGCCAACACTCTGGGCCTTCAAATGCGGTCCCCTTCCCCGGGAGG
CCGAAAACCGAACTTACTAGATGCTAGGAACTAGAACCTCTACCTCCCATTCAAATTCTCTCTATTTCCCAAGGCCCACG
ATGAGCGGAATCGCGGTTGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 121994878..121995138 261
NO GENE  


Sequence tag IST14651B1HMR1
Sequence
AGGGCTTCTTAGGACTCTCATGTTTCCATCACCTCCAACTGTGTCCATTTGCATCTTGGTGACCCACTGCGACACTTGGC
AGTGGCTCTGACCCCTCCTGATGGCTCTGAACCAAGCCTGTTTGAGACCTTCAACTTCAGGAGTTGCTTTACCTTTGCCC
AAAACCTGCCCTTTGGCTTTTCCCTTCTCTGTGCGTTCATTTCCTTCTGTTCTCTTGTCTACTCTCAAGAATCAAGAGTT
TATTTCTGAAGAGTTTAAAGCGCCCCGTATTCTAAAACGACCCCNAATGGGACTGGGAATATAGCNNGCTGGTANAGTAC
TCNCCATGCATGAACCCTTGGGTTTGATCCCTTGCACTGCAT
Sequence Type genomic DNA
Unitrap ID UNI24993

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 121994520..121994881 352
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029454 (Mapkapk5) NM_010765 MAP kinase-activated protein kinase 5 Gene [Source:MGI (curated);Acc:Mapkapk5-005]

 
Come back to gene ENSMUSG00000029454


For any suggestions or comments, please send an email to unitrap@crg.es