Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14586C4
Clone ID IST14586C4
Vector VICTR74
Project tigm

Sequence tag IST14586C4BBF1
Sequence
CTCCCTCTGTGACCGTTCTTGCTGGCCTCAGTCTCAGGATCT
Sequence Type genomic DNA
Unitrap ID UNI13119

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 126805009..126805049 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025405 (Inhbc) NM_010565 inhibin beta-C Gene [Source:MGI Symbol;Acc:MGI:105932]


Sequence tag IST14586C4HMR1
Sequence
GGAGGTGTTCATGAACCNGTGACTGCTCTGTGTTCTACTCCCCATTTGGTTACTGTGCGTCTGTCTAACTCAGCTTCAGT
ATGGCTAGGAGGGAGGAAGGGATAATTGATTTTTAGGACAGCAGCAGTGGCGTTTTANTAAATACTTAACAGCTGCTCTC
CAGGTGGGGGATACCTTAAAGCCCTGATTTGCAGTGATTTCTCTACTATAAATCCTATGGGGTCCAATGTCAAGGTTCTA
ATGCGGCATACCTGAACCCAGGTATGTCCACCACCANCTGTCCTAANTCCCACTANCCTCTGATTTANGTGAGGAGACCC
NNAACCTGATGCTAATGGTCTANTGGCTGGNANAGTGACNNAGANGANTCCNNANGGGGTGACTGTNTTTTGTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000025405


For any suggestions or comments, please send an email to unitrap@crg.es