Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_330B5-3
Clone ID CMHD-GT_330B5-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_330B5-3
Sequence
AGGATTCTGCCCTCAGAAGCACGTGAAATAGATCACTTCATTTAAAGTAGGAAAATAGTAGCACGTTTTCCTGGCTCTCC
AGACCTCTCCCAGGATGGAGGCAATCACATTCACAGCGAGGAAGCATCCGTTCCCTAACGAAGTCTCCGTGGACTTCGGC
TTGCAGCTGGTGGGCTCCTTACCCGTGCATTCTCTCACCACTATGCCCATGCTGCCGTGGGTGGTAGCCGAGGTACGAAG
ACTCAGTGGCCAGTGCTCTAAAAAGGAGCCTAGGACAAAGCAAGTCCGCCTTTGGGTTTCGCCCTCCGGACTGCGGTGCG
AGCCTGACCTGGAG
Sequence Type mRNA
Unitrap ID UNI13098

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 64564625..64564958 334
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029174 (Tbc1d1) NM_019636 TBC1 domain family, member 1 Gene [Source:MGI (curated);Acc:Tbc1d1-002]

 
Come back to gene ENSMUSG00000029174


For any suggestions or comments, please send an email to unitrap@crg.es