Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14221C6
Clone ID IST14221C6
Vector VICTR74
Project tigm

Sequence tag IST14221C6BBF1
Sequence
NGTTNATGNGATAGCANTTGAAAACAACACCCATAAGGGTTTTGTTACCTAGTTTTAATCTCTGAGCTGGGTTTTGTGCC
TGTTTGTTTATTANGTTGGTTGGTTTTGAGGGTTCAAATCTAACTAGATGCTGACTACAGTTTCATTGTTAACAATGAAA
CAATTTAAAACACAAATGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI19468

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97907108..97907289 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060739 (5730427N09Rik) NM_021552 RIKEN cDNA 5730427N09 gene Gene [Source:MGI Symbol;Acc:MGI:1913883]


Sequence tag IST14221C6HMF2
Sequence
CTCGGGTCTTCTGAAATCTTGGATACATCACTAGAAATCTCAGTTTCCGTCTTTCATCTATGACAGCACAGGTCTGAATG
ANAATTAAACCCACATATTTAATAAAAAGTGTGTCTAAAATTGCTTTTGGAGTATTTGAACTAAAGCAGTGAACAACAAC
AACGACTGTGCTCACACAGACTCTAGCCAACTCAAGGGCTACTAGGGGGAGGGGCTGAAATATACAACATCCTACTGTCA
TCGATGTTGCAGAAAGGAAGGGAAATGGAGCAGTTATGGTGTCAAGGGAGGCTTCACTAAAACTGTGAAATTAAAACTAA
AAAAAAAACTAANNTAGGTAAGGGANTCAATGTGGNANNANGGAGCATACTCTANCTTGANAAATTGCGTAATTTACTGC
NCCTGAAAATACNCGAATGCTAATCANCGCTAGCTCTGATTTAAACAAACAAACAAACAAAAANCATTATACTATGGGGA
NNTNANNGATAGTTTGAANCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97909118..97909618 460
 
EST/CDNA Est Name
  BY535378.1

 
Come back to gene BY535378.1


For any suggestions or comments, please send an email to unitrap@crg.es