Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12243D8
Clone ID IST12243D8
Vector VICTR76
Project tigm

Sequence tag IST12243D8BBF1
Sequence
AGATGACCACAATCGTAGTCCCATCAGAAGGGCGGAAGGCACGTGACAGGAAAAGAGCTGAGAAACTTTTATGGACCCAG
CTAAGGAAGAAACCCAAGAAGCCAACTGATGAATAACCAGAGAGCTAGAAAGCAAACTACAGCCAAGTGCACGCCAGTCA
CCAGGGATAGTCCAGGGAGGAAAGAGGCCAGGTGCTGAGAAGAGGGGCTTCAGTGGGAACAGTCTGTGCTTCACAAGAGG
CAGCCACAGGGGCTCTGAGGGGAGTGGTTTCCTCCAAGTGTTGGGGGTGGGGCCTGGGGCTCAAAGGTAGCTGTAGGAGG
TTTTGGAGTACGGAGGTCAAGGTCAAAGTGGCGTTCTAGAAGCTTCTTTCTGAAATGGATGTGTAAGGTCAGAGTAAGGA
AGAAGCCGAGGATAGGGGAGCAAAAGAGGAAACTACTACAGTATGCTTCCAGCCCAGAATGCAGCAGTGAGCTTANCTNA
NAAGACAGCTNGGANGCANGTNNNNGGAGTGCTANTTNNGGCTCAAAGCCNCCNATCN
Sequence Type genomic DNA
Unitrap ID UNI15215

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42668154..42668690 507
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032017 (Grik4) NM_175481 glutamate receptor, ionotropic, kainate 4 Gene [Source:MGI (curated);Acc:Grik4-001]

 
Come back to gene ENSMUSG00000032017


For any suggestions or comments, please send an email to unitrap@crg.es