Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14712B11
Clone ID IST14712B11
Vector VICTR76
Project tigm

Sequence tag IST14712B11HMR1
Sequence
TTATGTATAGCCTATGGAAAGAGATTCTGTTTGCAGAAATTTTACTATTAGGACATTANCTAAATGAAGAAGTGTAATAT
AATTTACATGGTTTGCTCTGGT
Sequence Type genomic DNA
Unitrap ID UNI3028

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72514055..72514156 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032216 (Nedd4) NP_035020 neural precursor cell expressed, developmentally down-regulated 4 Gene [Source:MGI Symbol;Acc:MGI:97297]


Sequence tag IST14712B11BBF2
Sequence
AAAGAACTAAAACTCAAGCCGGGCGTGGTGGCACACGCCTTTAATCCCAGGACTCGGGAGACAGAGGCAGGCGGATTTCT
GAGTTCGAGGCCAGCCTGGTCTACAGAGTGAGTTCAAAGACAGCCAGGGCTACACAGAGAAACCCTGTCTCAAAAAAACC
AAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72513884..72514055 172
NO GENE  


Sequence tag IST14712B11HMF1
Sequence
NGANTGNNNNANNNNNTANTTGTATCANANTTCGTANNNNTNATAGACCAANAANACAGAACTTATATCCNAGACTTCTT
CACCATTTGGTACNNCCNGTGTGCCGGGAACCNAAGCACANCANCTGGAGTCCCAAATGANACTATGGGGATACAGCCNT
GACCNANTTANTCCTGNNCNAANTGTGTGGGTCTGTAATCTTANCANCTGNNNNGCTGAGGCNNTANGATCANGANNANN
NTGANTTCNAAACCNTCCTGGGCTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000032216


For any suggestions or comments, please send an email to unitrap@crg.es