Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14673F12
Clone ID IST14673F12
Vector VICTR74
Project tigm

Sequence tag IST14673F12HMR1
Sequence
GGAAGCTCTAAGAAAAGCCNGAAACCAAGNCCAGACCTGACCNCACATACTCAGATCTCTCCACATTATAAATGCGAGTG
TAGCATCTACATTCCGATAGCTTCTTACAGGGGTCAGGAAGGGAAAAGGAAGATGTCTTAGCCAAGTTTGCCTGTGACTA
AACACCAGATAGCTAGCTCCATGTCTATGTATCTGTGTTTNCNTTCCTAANTGTGTTNCTTANNGTTTAAAAAGATGCAT
GTGTATGCCCGGGTGTTTGTATGTGTAACACATGTCTCAGGTACCTGCAGAGACCAGAAGAGGGCGCTGGATCTCCTGAN
GCTGGAATTACAAGTGGTTGTGAGCCATGGATCATGGGTACTTGGAACTGGGCCTGGGCCCTCTGTGCTCTTANCTGCTA
AGCTATCTACCNNACCAGCNTCTGTGTTCATGTTCTTTTCCC
Sequence Type genomic DNA
Unitrap ID UNI29721

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 87165644..87166084 413
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024140 (Epas1) NM_010137 endothelial PAS domain protein 1 Gene [Source:MGI Symbol;Acc:MGI:109169]


Sequence tag IST14673F12HMF1
Sequence
CCCTGAGGCTTCCAGAAGGGATGGCCCGAGGTCTCAGTTAGCTCCTGGATAAGGGCCAGTCTGTACTGTGCTGCAAAGCT
CCACTGTCCCCTGTCCCTATGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 87165545..87165645 101
NO GENE  


Sequence tag IST14673F12BBF1
Sequence
CCCTGAGGCTTCCAGAAGGGATGGCCCGAGGTCTCAGTTAGCTCCTGGATAAGGGCCAGTCTGTACTGTGCTGCAAAGCT
CCACTGTCCCCTGTCCCTATGTGGTTCTGGCAGGCGATTACGGCTCCTTGGCTCCAGAAGACTCTTCTCTGGGCTCAGGC
TTTAACCTGAGCAAACCACTGGCCTAACCAGCCTGCCAGAACTGAGCAGTGGTTCCTCCGTCCTACAACCNCAGGGGACA
GAACTANNANTTGAGACATGACNGTTGTCATTGTGAGGTTAAANTTTAACACAAANCCATCTANGANCCNTTCCCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 87165330..87165645 296
 
EST/CDNA Est Name
  W64505.1 - BE623903.1 - AA028545.1 - BI133704.1 - BI133234.1 - AW457693.1 - AA874463.1

 
Come back to gene W64505.1 - BE623903.1 - AA028545.1 - BI133704.1 - BI133234.1 - AW457693.1 - AA874463.1


For any suggestions or comments, please send an email to unitrap@crg.es