Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14446A4
Clone ID IST14446A4
Vector VICTR74
Project tigm

Sequence tag IST14446A4HMF2
Sequence
GGTAAGAGCACCCGACTGCTCTTCCGAANGTCCTGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCGTAA
TGAGATCTGACTCCCTCTTCTGGAGTGTCTGAAGACAGCTACAGTGTACTTACATATAGTAAAAATAAAATAAATTTTAA
AAAGTTTGATCTTGTTACATTAATTTCTGAGTTCAAGGACAGCCTGGTCTACATAGTGAGTTCCAGGACAGCCNGANCAA
CAAGGGAGTTTTGTTGTCTCAAAANCAACANANNNAANNNATANNNCNNNNCNNTTNNNATATATACNTAN
Sequence Type genomic DNA
Unitrap ID UNI14364

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71190894..71191163 262
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027010 (Slc25a12) NM_172436 solute carrier family 25 (mitochondrial carrier, Aralar), member 12 Gene [Source:MGI (curated);Acc:Slc25a12-001]


Sequence tag IST14446A4HMR1
Sequence
TACCCACTGAGCCNTCTNACNANCCCCAAACTTTAAAAAAAAAATACNCNTAACCAAAACTGANGTNNCATATCTAAAAA
AACTACTTTTTAACCCNAAAATCTGTGGTAATCAAATCTGTTTGTGTCATTTTTATGTTCANNANAATTCCCNTGCTGGG
CACCATAACCCTGACNNTTGCGGCCTAAACAAACGGGTCTNACTGCANATNANTGAAACATACCCCAGGTCNNGAAGGAT
GGACAATAAANTNNNGGTCNNAATCCGGGGCCNTTAACTNATAGGGGACTTCTTGGCTAANGGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14446A4BBF1
Sequence
GGTAAGAGCACCCGACTGCTCTTCCGAAGGTCCTGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCGTAA
TGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI14364 UNI18085 UNI31159 UNI36837

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 23534751..23534839 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037455 (AC153973.1) NP_898939  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 29659246..29659334 89
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 27463429..27463517 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021877 (Arf4) NM_007479 ADP-ribosylation factor 4 Gene [Source:MGI Symbol;Acc:MGI:99433]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 56695749..56695837 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053644 (Aldh7a1) NM_138600 aldehyde dehydrogenase family 7, member A1 Gene [Source:MGI Symbol;Acc:MGI:108186]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71191075..71191163 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027010 (Slc25a12) NM_172436 solute carrier family 25 (mitochondrial carrier, Aralar), member 12 Gene [Source:MGI (curated);Acc:Slc25a12-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 109907645..109907733 89
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 20465717..20465805 89
NO GENE  

 
Come back to gene ENSMUSG00000027010


For any suggestions or comments, please send an email to unitrap@crg.es