Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_326H4-3
Clone ID CMHD-GT_326H4-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_326H4-3
Sequence
CCAATGGGCGTGTCTATTATGTTGATCACAACACCAAGACCACCACCTGGGAGCGGCCTCTTCCTCCAGGGTGGGAAAAG
CGCACGGACCCCCGAGGGAGGTTTTACTACGTGGACCACAACACCCGGACAACCACCTGGCAGCGCCCAACTGCTGAGTA
CGTGCGCAACTATGAGCAGTGGCAGTCCCAGCGGAACCAGCTGCAGGGGGCCATGCAGCACTTCAGCCAAAGATTCCTCT
ACCAGTCTTCAAGTGCTTCCACTGACCATGATCCCTTGGGCCCCCTCCCACCTGGCTGGGAGAAGAGGCAGGACAATGGA
CGGGTGTATTATGTCAACCACAACACTCGCACTACCCAGTGGAAGGACCCTCGGACCCAGGGGATGATACAGGAGCCAGC
CCTGCCCCCAGGGTGGGAGATGAAATACACCAGCGAGGGCGTGCGGTACTTTGTGGACCACAATACCCGCACCACTACCT
TTAAGGATCCTCGCCCAGGGTTCGAGTCAGGGACAAAGCAAGGCTCACCTGGTGCCTATGACCGAAGTTTTCGGTGGAAG
TATCACCAGTTCCGTTTCCTCTGCCACTCAAATGCTCTACCCAGCCATGTGAAGATCAGCGTTTCCAGGCAGACACTCTT
TGAGGATTCTTTCCAACAGATTATGAACATGAAACCTTACGACCTGCGCCGCCGGCTCTACATCATCATGCG
Sequence Type mRNA
Unitrap ID UNI11722

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 110057120..110073999 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031930 (Wwp2) NM_025830 WW domain containing E3 ubiquitin protein ligase 2 Gene [Source:MGI Symbol;Acc:MGI:1914144]

 
Come back to gene ENSMUSG00000031930


For any suggestions or comments, please send an email to unitrap@crg.es