Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10381A10
Clone ID IST10381A10
Vector VICTR76
Project tigm

Sequence tag IST10381A10HMF1
Sequence
AGTCTTACTATTGTAGTGCTTTGCTTGTAAACAGTCCCTTTGAGAAGCAGGAGGATAAATGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI19271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114465670..114465735 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031950 (Gabarapl2) NM_026693 gamma-aminobutyric acid (GABA-A) receptor-associated protein-like 2 Gene [Source:MGI (curated);Acc:Gabarapl2-001]


Sequence tag IST10381A10BBF1
Sequence
AGTCTTACTATTGTAGTGCTTTGCTTGTAAACAGTCCCTTTGAGAAGCAGGAGGATAAATGTTAACTGTTCAGAGANAAN
CAACAGGCCNNATGAAAATGTCNGCTCTTGGGTGGCTGTANTTGTATANCTTTGCCCTTANTTCATCCATTTCTTTCCNG
TGTTGTTGGGGATTGGAATGCTCTAACAGGGTCTATCTATGGATCAAAANATGACNNATGANNCCCTANCCANATCAATC
TTTTNNTNNGCCTANNTAAAATGTTAGANNNCTACCCTTGCNNTGGGGTGGCACGTGCCTTCNNTCCCAACATTNANGGG
TCANNNGCAGCTGATCTNNNAGTTTGGGGACNGCCTGGTCTACAGTTCCNGGACATCTGGGACTAACNNANAGACCCTGT
CTNTGGAAGAANATANANAGCTTTGTAGCTGTGCTTCTCTTACAAACGCTGANATCANAAATGANGAATATCANTNNGCT
CTGGGCCTCCNNANCGGGGCTTCTTGANCTGTGGGCATATTGATTTACTNNTCTGTGCCNNTTCCCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031950


For any suggestions or comments, please send an email to unitrap@crg.es