Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14424F2
Clone ID IST14424F2
Vector VICTR74
Project tigm

Sequence tag IST14424F2HMR1
Sequence
CTTTAAGCAGTGCCTTANCCGCACACAAGTTCTGTTACTCTCTTTATTCTTATCTCCTTGCTGTAAGTGGAAATTACAAA
CTGAGTTTCTTGAGGCCTCTGCAGATCCAGTGGCTAGTCACCAACCTCCTGGTTTGCCTCTCTCAGCCTTTGCGTAACTT
CTTGGGCTGAAAGGAAACTTGAGGGCAAAGCGTTTGTCCTCTAAGAGCACGCATTAAAATGGCTCCTACAGGTTTGGGAA
GCCAGGATCTGTTTGTGAGTGTGAACCTCANCCAATTTCCCAGCCCTGACTCAAGCTGGCTGCTTTTCCTCGTGGCN
Sequence Type genomic DNA
Unitrap ID UNI29535

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165707665..165707980 312
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]


Sequence tag IST14424F2BBF1
Sequence
AAAGAACATTATACCCCACCTGTGTTTGACTCGGCGACACCGGCCTGCCCCACACAGACTGCCCAGTTGATAATTTAGTC
CGTCTCTCTTTACTAAGTGAACCTTTTTCAACTGATGTCAAAGCTTCAGCTGCCTGAACACTAGAAGAAAAAAAGTCAAG
AGTCTGTGCCGTTGGCCTAGGATAACCACTGCTCAGAGACAGCCCTTCCATGCAGCCTGACTGGGTCTCAAAGCAGGAAC
TAGATGTGGTGAGTTTCCAGGTGGACCCTGAAGGTGAGGACTTTAANATTCTAGCTGCAGCCTCAAAAGTAGGGCAAATG
CAAAGCCAACATGTACAGGGGTGTGTGGCCCANACTTTCANGGAGGTGAAGGCTGTNTCTANTGGTCNNTGNGTTCTAAG
CNNNACCTAGTTTGGGAGTGGCNNNGCNNCNNTTCTANATGTANNCACNNNAAANCTTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es