Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14326C1
Clone ID IST14326C1
Vector VICTR74
Project tigm

Sequence tag IST14326C1HMR1
Sequence
CGCTATGGCCCTAGATGTTTGTGGACCATGCAGAGTCATTGCATCAGTGCCCGGTCTGGATCTGAANAATCATCGATGGG
TTTCCTCAAC
Sequence Type genomic DNA
Unitrap ID UNI27420

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101433692..101433781 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078941 (4921516M08Rik) NM_027592 Adenylate kinase isoenzyme 6 (EC 2.7.4.3)(ATP-AMP transphosphorylase 6) [Source:UniProtKB/Swiss-Prot;Acc:Q8VCP8]

 
Come back to gene ENSMUSG00000078941


For any suggestions or comments, please send an email to unitrap@crg.es