Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13596G2
Clone ID IST13596G2
Vector VICTR74
Project tigm

Sequence tag IST13596G2BBF1
Sequence
CCTCCAAGGATGGANACCCATCAGGCCCTAGGGCCACCAACGACCTGGTTTTGCGAAGGGCAAGGCACCAGCAGCTGTCT
GGGGATCTTGCTGTGGANAAGCGACCGTCTCGAACTGGGGGCAAAGTTATCAAGTCGGCTTCAGCTACAGCCTTGTCANT
CATGATTCCTGCAGGTGAAGTGGGGCACCNCACACCAGGGAAGGGGCTCCCTGCNNTTGTGGCANGAANNTTGTTTGNCN
Sequence Type genomic DNA
Unitrap ID UNI31822

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87440389..87440625 219
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053693 (Mast1) NM_019945 microtubule associated serine/threonine kinase 1 Gene [Source:MGI (curated);Acc:Mast1-001]


Sequence tag IST13596G2HMF1
Sequence
CCTCCAAGGNTGGANACCCATCAGGCCCTANGGCCACCAACGACCTGGTTTTGCGAAGGGCANGGCACCAGCAGCTGTCT
GGGGATCTTGCTGTGGANNANCGACCGTCTCGAACTGGGGGCAAANTTATCANNTCGGCNTCANCTACAGCCTTGTCAGT
CATGATTCCNGCNNGTGAANTGGGGCACCNCNCNCCAGGGANGGNGCTNCCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000053693


For any suggestions or comments, please send an email to unitrap@crg.es