Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12680A9
Clone ID IST12680A9
Vector VICTR76
Project tigm

Sequence tag IST12680A9BBF1
Sequence
AAAACAATTTATTATCTTTAAAATCAATATTAGAAGCATTACTATCATATTACGAAGTTTGGATGTCAATTAATACCTAT
GAATACCTN
Sequence Type genomic DNA
Unitrap ID UNI16988 UNI30509 UNI31035 UNI32321

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166342: 220321..220408 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166390: 86332..86419 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166370: 32980..33067 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166344: 256174..256261 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161911: 167607..167694 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161872: 823048..823135 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161902: 647484..647571 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 38948052..38948139 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048720 (Tbc1d12) NM_145952 TBC1D12: TBC1 domain family, member 12 Gene [Source:MGI Symbol;Acc:MGI:2384803]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 9893248..9893335 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 13357534..13357621 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 20906299..20906386 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 74658819..74658906 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 23420462..23420549 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 22841449..22841536 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 6648948..6649035 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7803685..7803772 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 112769322..112769409 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 23580775..23580862 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020010 (Vnn3) NM_011979 vanin 3 Gene [Source:MGI (curated);Acc:Vnn3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 5222800..5222887 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 67604785..67604872 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 14346826..14346913 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070811 (C730007P19Rik) RIKEN cDNA C730007P19 gene Gene [Source:MGI Symbol;Acc:MGI:3690091]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3255699..3255786 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40554051..40554138 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52921396..52921483 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048332 (Lhfp) NM_175386 lipoma HMGIC fusion partner Gene [Source:MGI Symbol;Acc:MGI:1920048]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 15920519..15920606 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 110306261..110306348 88
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 3792894..3792981 88
NO GENE  


Sequence tag IST12680A9HMF1
Sequence
AAAACAATTTATTATCTTTAAAATCAATATTAGAAGCATTACTATCATATTACGAAGTTTGGATGTCAATTAATACCTAT
GAATACCTATTAAAGCAAGCTTTAATGCTTTAATAAAGAGACATTC
Sequence Type genomic DNA
Unitrap ID UNI16988 UNI30509 UNI31035

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 10811036..10811160 125
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 24049823..24049947 125
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 6648948..6649072 125
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 52077660..52077784 125
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 112769322..112769446 125
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 74658819..74658943 125
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 25519264..25519388 125
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 22438818..22438942 125
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 9893248..9893372 125
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 38948052..38948176 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048720 (Tbc1d12) NM_145952 TBC1D12: TBC1 domain family, member 12 Gene [Source:MGI Symbol;Acc:MGI:2384803]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 110306261..110306385 125
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52921396..52921520 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048332 (Lhfp) NM_175386 lipoma HMGIC fusion partner Gene [Source:MGI Symbol;Acc:MGI:1920048]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40554051..40554175 125
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 87467138..87467262 125
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 88521876..88522000 125
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 14346826..14346950 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070811 (C730007P19Rik) RIKEN cDNA C730007P19 gene Gene [Source:MGI Symbol;Acc:MGI:3690091]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 5222800..5222924 125
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7803685..7803809 125
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161872: 823048..823172 125
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161902: 647484..647608 125
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166370: 32943..33067 125
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166390: 86332..86456 125
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 21197437..21197561 125
NO GENE  

 
Come back to gene ENSMUSG00000070811


For any suggestions or comments, please send an email to unitrap@crg.es