Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_327E3-3
Clone ID CMHD-GT_327E3-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_327E3-3
Sequence
CTAAAGAGGGCCTTGCAGAAAGTGAACCGATGATATGTCACACCTTACCTTTGCCTGAAGGATTTCAGGTGGTGAAAGTG
GGGGCCAATGGAGAAGTGGAGACACTAGAGCAGGGCGAGCTTCCTCCTCAGGAAGACTCTAGCTGGCAAAAAGACCCAGA
CTATCAGCCACCAGCC
Sequence Type mRNA
Unitrap ID UNI1536

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108188090..108188265 176
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005698 (Ctcf) NM_007794 CCCTC-binding factor Gene [Source:MGI (curated);Acc:Ctcf-001]

 
Come back to gene ENSMUSG00000005698


For any suggestions or comments, please send an email to unitrap@crg.es