Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_326A1-3
Clone ID CMHD-GT_326A1-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_326A1-3
Sequence
TGCCCACTACATGTGGCAGGCATGCCTGGCATCTCTGCCTCCTTTCACACTGCAGTGCTGAATCTGCTCAAAGCCAACGC
AGCTGCTGGCACCACTGGCAGGGGCTCGTGCTGCGTGCCTACATCTCGGCGCCCTCTGTCTTTGCTCTACTATGACAGGG
ACAGCAACATTGTCAAGACGGATATACCTGACATG
Sequence Type mRNA
Unitrap ID UNI13119

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 126794170..126794364 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025405 (Inhbc) NM_010565 inhibin beta-C Gene [Source:MGI Symbol;Acc:MGI:105932]

 
Come back to gene ENSMUSG00000025405


For any suggestions or comments, please send an email to unitrap@crg.es