Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15056C4
Clone ID IST15056C4
Vector VICTR80
Project tigm

Sequence tag IST15056C4HMR1
Sequence
NNGTGTGGGAGAGTTCACGCCTTTAATTCCCAGCCTACGCAGGCAGATCCCTGAGTTTCAGGCCAGCCTCCTCTACAAAG
GGAGCTCCAGGGCAGCCTGGACTACAGAGAGAAATCCTACCTCAAGAAACAAAACAAAATTTTGCAAAAATCATTTTGAA
AGAGAAATTGCCTGTGTCTCAAGAGAAGAATGGGTTGGGTGTTACAGTCAGCCTGCAGGATGTAAATTCTTGAAACATCA
CAGCAGCATTTTTATAACAGCATAAAAGTAGGGGGTGGGGTGAAGGAAAGAACAGCACGGAAATAAACAATGACTTAGTA
GGATACTCATGATACACACATGGAAGATGATAATGCGCACCAATAAATTAACTATAACTGTACACTTCAATATAAATGAA
TCTCACACACACACACAAAGGCAAATTCTAGAATCCCACTGCAGANGACCTAAGTCTATCAAAGCCNAGGACTTCTTAGT
GACCCCTAGTGACNNTCAGGAAGCANANGCCTAGCTTGATTGCATTTCTCGGANGTTCCANAANCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7498270..7498810 525
NO GENE  


Sequence tag IST15056C4HMF1
Sequence
CAAGTTTAATTTCCAACAGAGAAATGTTATAGTGTTATTCCAAACCTGGCACCTGCCCCAACCCCCCCCCCAAAAAAAAC
A
Sequence Type genomic DNA
Unitrap ID UNI28989

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7498825..7498904 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039278 (Pcsk1n) NM_013892 proprotein convertase subtilisin/kexin type 1 inhibitor Gene [Source:MGI (curated);Acc:Pcsk1n-001]

 
Come back to gene ENSMUSG00000039278


For any suggestions or comments, please send an email to unitrap@crg.es