Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11693A9
Clone ID IST11693A9
Vector VICTR76
Project tigm

Sequence tag IST11693A9HMF1
Sequence
TTGGGACATATCTGAAGCAAGCGTCTTCGACGCCTACGTGCTTCCCAAGCTCTATGTCAAGCTGCATTATTGCGTGAGCT
GTGCCT
Sequence Type genomic DNA
Unitrap ID UNI86

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 128062341..128063148 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025362 (AC117232.3) NM_013765 40S ribosomal protein S26 [Source:UniProtKB/Swiss-Prot;Acc:P62855]


Sequence tag IST11693A9BBF1
Sequence
TTGGGACATATCTGAAGCAAGCGTCTTCNACGCCTACNTGCTTCCCAAGCTCTATGTCAAGCTGCATTATTGCGTGAGCT
GTGCCATCCATAGCAAGGTTGTTAGGAATCGATCCCGCGAANCCCGGAAGGACCGAACACCCCCACCACGATTCANACCT
GCTGGCGCTGCACCTCGACCTCCACCAAAGCCCATGTAAAGAGGCCGTTTTGTAAGGACANAANGAAAACTACNNTGGAA
AAATAAAATGGAANTTGTACTTNAAAAAAAAAAAAAAAAAANAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109963029..109963311 261
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059775 (Rps26) NP_038793 ribosomal protein S26 Gene [Source:MGI Symbol;Acc:MGI:1351628]

 
Come back to gene ENSMUSG00000059775


For any suggestions or comments, please send an email to unitrap@crg.es