Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_337B5-3
Clone ID CMHD-GT_337B5-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_337B5-3
Sequence
TTGGAAGAAGGGAAAGGGAGAAGAAGTGGTGCTCCCCGCCTGGTACACGATGGCACGGGAGGAGTCATGGTCCCACCCCC
GGGAGGTGCCCATCCTGATCTGGTTCTTGGAACAAGAAGGGAAGGAACCAAACCAGGTGTTGTCTTACATTAATGGAGTC
ATGACAAATAAACCTGAAACAGCCCTGGACCAATCTATCTCTTCACGGAATGTGTCCCTGCAACTGGGGGCACTCCAGGA
GGGAGACTCTGGGACTTACCGCTGTTCTGTCAATGTGCAGAATGATGAAGGCAAAAGTATAGGCCACAGCATCAAAAGCA
TAGAGCTCAAAGTGCTGGTTCCTCCAGCTCCTCCATCCTGTAGTTTACAGGGTGTACCCTATGTCGGGACCAATGTGACC
CTGAACTGCAAGTCCCCAAGGAGTAAACCTACTGCTCAGTACCAGTGGGAGAGGCTGGCCCCATCCTCCCAGGTCTTCTT
TGGACCAGCCTTAGATGCTGTTCGTGGATCTTTAAAGCTCACTAACCTTTCCATTGCCATGTCTGGAGTCTATGTCTGCA
AGGTTCAAAACAGAGTGGGCTTTGCCAAGTGCAACGTGACCTTGGACGTGATGACAGGGTCCAAGGCTGCAGTGGTCGCT
GGAGCAGTTGTGGGCACTTTTGTTGGGTTGGTGCTGATAGCTGGGCTGGTCCTGTTG
Sequence Type mRNA
Unitrap ID UNI13131

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 37339126..37344670 195
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001946 (Esam) NM_027102 endothelial cell-specific adhesion molecule Gene [Source:MGI Symbol;Acc:MGI:1916774]

 
Come back to gene ENSMUSG00000001946


For any suggestions or comments, please send an email to unitrap@crg.es