Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14556C9
Clone ID IST14556C9
Vector VICTR74
Project tigm

Sequence tag IST14556C9HMR1
Sequence
TTATTTTGGTTTTTGAGACAGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGAACTCACTTTGCAGACCAGG
Sequence Type genomic DNA
Unitrap ID UNI11078 UNI19067

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 36762540..36762610 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 62615864..62615934 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 13523714..13523784 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 70792970..70793040 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018446 (C1qbp) NM_007573 complement component 1, q subcomponent binding protein Gene [Source:MGI (curated);Acc:C1qbp-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 41862141..41862211 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 59369762..59369832 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 45638734..45638804 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 84006203..84006273 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033788 (Dysf) NM_021469 dysferlin Gene [Source:MGI (curated);Acc:Dysf-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 69225550..69225620 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 68759249..68759319 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 32681375..32681445 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 39178946..39179016 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 11697277..11697347 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 7203841..7203911 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 72279048..72279118 67
NO GENE  


Sequence tag IST14556C9BBF2
Sequence
AAATAAAATAAAATAAAATATAAAAAGGAAAAAAAATTGGAAAAAAAGATTACAGAAATCAAACATAAGCCCACTAGATT
GCAAGTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000033788


For any suggestions or comments, please send an email to unitrap@crg.es