Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14352G7
Clone ID IST14352G7
Vector VICTR74
Project tigm

Sequence tag IST14352G7HMF1
Sequence
TAGTCATGGAAGACAGTTATCAACATCTCAAACTGTTACACTAAAATGGCATTCTGAAAACAGTGATTTCTAGGAATCAG
GAATAAGAGGTAAGATATAAAGAGACAACATGAGGTTTTAACAGGTAGCAGGACTGGTTTCATATCCTGACCAGATATAT
GAATCTAAAACTCTCCAAATGGTTATTTGGGTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 33777716..33777916 201
NO GENE  


Sequence tag IST14352G7HMR1
Sequence
NTATATAAACACCTTTGAGATTCNAGATGCGGCCCTGTTGGTTATTGGGGGGACAGGCTCTTCATATCTTTTTGAGACAA
GATCTCAGGTGGTCCAGGCTAGCCTCAGACTTGCTCCAGTAGCAAGGATAATCATGACCTTAGGATTCTTCTGCCTCTAC
CTCCCTAGTGCTGGGATGACAGACATGTGCCGTCATGCCAGGTGTGTGTGTGTGTGTGTGTGTN
Sequence Type genomic DNA
Unitrap ID UNI22346

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 33777917..33778138 220
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004768 (Rab23) NM_008999 RAB23, member RAS oncogene family Gene [Source:MGI (curated);Acc:Rab23-001]

 
Come back to gene ENSMUSG00000004768


For any suggestions or comments, please send an email to unitrap@crg.es