Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_323A2-3
Clone ID CMHD-GT_323A2-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_323A2-3
Sequence
CAACAACTTAATCACAGTAGGTCCGCCACGCACCAAACCTGAAGTGATTTTCAAGTGGCCAGCATGAGGAAGAGCCTTGG
GTGGTGGAGAGAGAAGTGCTGTGGAGACCCTGTCCAGTTATGGTTGGATCTGGCATGTTTCCCCCAAAGAAGGTCCCCAA
AACAACAATGTTCAGAACTGATCTGGTCACGAGGGTTCTGACCTCGTCAAAGATGAATCTACTTACGGAATCCTAGCGGA
TACCAAAAGACATTCTTGTCATAGTACCAGGAAGCTGTCTGTCTCACTCGTCAGAACCTTTATCGGGATAATGCCAGCCA
ACAGCATAAACCATTTGAGGCTAGTCC
Sequence Type mRNA
Unitrap ID UNI13145

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 30717164..30722980 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059975 (Zfp74) NM_178384 zinc finger protein 72 Gene [Source:MGI (curated);Acc:Zfp74-003]

 
Come back to gene ENSMUSG00000059975


For any suggestions or comments, please send an email to unitrap@crg.es