Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13639D8
Clone ID IST13639D8
Vector VICTR74
Project tigm

Sequence tag IST13639D8BBF1
Sequence
TGTATATGCCAATATTCACAGCTATTTGGGACATTGGAGATGATTGTTTTAACATAGGCATTAGAGACCAGCCTCAAACA
CAAAGTAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134658867..134658959 93
NO GENE  


Sequence tag IST13639D8HMR1
Sequence
TACAGATATCAAGNTATGTCTGTCTAAGCAAGTTCTTACAGGTATTTGATACAGAGTAAGTATCTAAGACATAGGGATAG
ATAGTATGTTGAGAAAGGGTCTCCGAGTCAATGCATAGCCAAAGATGAACTTGAACTTCTGATCTTCCTTTACCTCTCAA
GCTTTTGGATTGAAGGTGTGTGCCC
Sequence Type genomic DNA
Unitrap ID UNI14764

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134658956..134659139 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053877 (Srcap) Snf2-related CREBBP activator protein Gene [Source:MGI Symbol;Acc:MGI:2444036]

 
Come back to gene ENSMUSG00000053877


For any suggestions or comments, please send an email to unitrap@crg.es