Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12843H9
Clone ID IST12843H9
Vector VICTR76
Project tigm

Sequence tag IST12843H9HMF1
Sequence
CCCCCCTCCCGCCCGGTTTATTTTGGTTCCCGCTCCGGGAGGAAGAGGTCAAGGGGGGGTCATCCCCCTTCGCTTCCGGA
TACTGGGAGGAGCGGAATTGGGAAGGGAGGAGAAGGGTCCCACGGGAGAAGGGATCCTGAAACCCTCCGGGGAANAGCTG
AGGCTGGGAGANCNGNTTTACAGGGGGCCGGAATGGAGGANAGANAGGTTTGGAGTTTCCCNCTGCCNCCNCACATGGTT
CGGGAGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI26978

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97525336..97525586 233
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038437 (Mllt6) NM_139311 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 6 Gene [Source:MGI (curated);Acc:Mllt6-001]


Sequence tag IST12843H9HMR1
Sequence
NNATCTTTGGCTGGCATTGTCAGCTCTTATGGTGGTAGGATGATGGTCAAGAATGTTC
Sequence Type genomic DNA
Unitrap ID UNI6248

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 32059187..32059241 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041444 (Grit) NM_177379 Rho GTPase-activating protein Gene [Source:MGI Symbol;Acc:MGI:2450166]

 
Come back to gene ENSMUSG00000041444


For any suggestions or comments, please send an email to unitrap@crg.es