Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_324H1-3
Clone ID CMHD-GT_324H1-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_324H1-3
Sequence
ATGAGAAAGAGGACAGAGTTGTTCAGTCTTTACTCAACAAGCTGATCAGAAGCAATCTTGTGGATAACACCAACCAAGTG
GAAGTCCTGCAGAGGGACCCAAGCTCCCCGCTCTACTCAGTGAAGTCCTTCGAAGAGCTTCGCCTGAAACCACAGCTTCT
CCAGGGAGTCTATGCTATGGGTTTCAACCGCCCTTCC
Sequence Type mRNA
Unitrap ID UNI13155

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 113513373..113513514 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015023 (Ddx19a) NM_007916 DEAD (Asp-Glu-Ala-Asp) box polypeptide 19a Gene [Source:MGI (curated);Acc:Ddx19a-001]

 
Come back to gene ENSMUSG00000015023


For any suggestions or comments, please send an email to unitrap@crg.es