Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14509G1
Clone ID IST14509G1
Vector VICTR74
Project tigm

Sequence tag IST14509G1HMR1
Sequence
GTAACCGGCTTTTCTCCCTTTGGGTCNTCTTGGCTTTTCTTTTAGGAGACAAGGCCTTCGTTGAATTCTTGACTGATGAA
ATTAAGGAAGAAAAGAAGATCCAGAAACACAAGTCCCTTCCCAAGATGTCTGGAGATTGGGAGCTGGAGGTGAACGGCAC
GGAGGCTAAATTATTGCGCAAAGTTGCCGGAGAAAAGTAAGTGGCCCAGGGCTTGTATTCTGGGTTCTCAAGTCGGGAAT
CCCTGACTACAGCACCCTGTCC
Sequence Type genomic DNA
Unitrap ID UNI10749

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 70795606..70795867 260
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018446 (C1qbp) NM_007573 complement component 1, q subcomponent binding protein Gene [Source:MGI (curated);Acc:C1qbp-001]


Sequence tag IST14509G1HMF1
Sequence
CCGATAGACCGGACTGTATCCATTCTTACGACACTANCCCAAATCACTCCTTAAAACGTCCGTTTCTCACTCTATAAAAA
GAGCAGGATATACTTACTGAGCTGAACTGATATTTATCATGAGATGGTTATTTCTTATCATGGACTCACC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 70795867..70796015 147
NO GENE  

 
Come back to gene ENSMUSG00000018446


For any suggestions or comments, please send an email to unitrap@crg.es