Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_324C9-3
Clone ID CMHD-GT_324C9-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_324C9-3
Sequence
GTCTCTTAACCTTCATTAACTGTGCCTATGTCAAGTGGGGAACCCTGGTCCAAGATATTTTCACCTACGCTAAGGTGTTG
GCGCTGATTGCAGTCATCATTGCAGGCATTGTTAGACTTGGCCAGGGAGCCACAGCTAACTTTGAGAACTCCTTTGAGGG
CTCATCCTTTGCAATGGGTGACATTGCTCTGGCACTCTACTCAGCCCTGTTCTCCTACTCGGGCTGGGACACCCTTAACT
ATGTCACCGAAGAGATCAGGAACCCCGAGAGGAACTTGCCCCTCTCCATTGGCATTTCCATGCCGATCGTCACCATCATC
TACCTCTTGACCAATGTGGCCTATTACAGTGTGCTAGACATAAAGGAAATCCTGGCCAGTGACGCTGTTGCCGTGACCTT
TGCCGATCAAATTTTTGGAGTATTCAATTGGATAATTCCAGTAGCGGTTGCATTCTCTTGCTTTGGTGGGCTCAACGCCT
CCATCGTGGCTGCTTCCAGGCTTTTATTTGTGGGCTCGAGAGAAGGCCACCTCCCTGACGCCATCTGTATGGTTCATGTT
GAACGGTTCACACCAGTGCCTTCTCTACTCTTCAATGGTGTGTTGTCCCTGGTCTACCTGTGTGTGGAGGACATCTTCCA
GCTCATTAACTACTATAGCTTCAGCTACTGGTTCTTTGTGGGCCTTTCTATTGTGGGTCAGCTTTATCTACGCTGGAAGG
ACCCCGACCGGCCTCGCCCTCTCAAGCTCAGCCTTTTCT
Sequence Type mRNA
Unitrap ID UNI13165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 54992617..54998909 149
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000958 (Slc7a7) NM_011405 solute carrier family 7 (cationic amino acid transporter, y+ system), member 7 Gene [Source:MGI Symbol;Acc:MGI:1337120]

 
Come back to gene ENSMUSG00000000958


For any suggestions or comments, please send an email to unitrap@crg.es