Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13927G4
Clone ID IST13927G4
Vector VICTR74
Project tigm

Sequence tag IST13927G4HMF1
Sequence
GTAGTCGGCTCTCAGCCCGCCTGTCTCCCCCAATACGCAGCGGCACGAGCGGCAGGCGCAGCAGCGCTTTCAGCAGCAGC
AGCGGCGGCGGCGCGAGGAGGAGGAGCGGCAGCC
Sequence Type genomic DNA
Unitrap ID UNI33523

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 74000748..74000860 113
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034863 (Ano8) anoctamin 8 Gene [Source:MGI Symbol;Acc:MGI:2687327]

 
Come back to gene ENSMUSG00000034863


For any suggestions or comments, please send an email to unitrap@crg.es