Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11409A10
Clone ID IST11409A10
Vector VICTR76
Project tigm

Sequence tag IST11409A10HMR1
Sequence
AGCATACCAATAAAGAACAAAAGTAAATTATTATTTGTTTTTTATAGCTGGGCTTGGTGATTCGGGTGCATACTTCCTGC
ACATGTTAATGTACGTGCTCAGAACTGCGCTAATTATAATCCATTGGTGTTTCTGAACATATCTAAAATTAAAATATAAA
GGATAGCCAAGGGCGTTGTGGTGCTCGCCTTTAAGACCCGCACTTAGGAGGTAAAGGCTTGTGGAGCTCTGAGAGTTTGA
GACCCACCTGGTGTACACAGTGAGCCCCTGCCTCTAAATAAATAAACAGACAAATAAATAAATAACCNCGTTTCACTTGG
CCTGGTCACTTACTGTGAATGGACCATGCAGACTTCANGTTGCTGAAGTAAAGTGAGTGTTC
Sequence Type genomic DNA
Unitrap ID UNI33526

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 50243326..50243706 375
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020375 (Rufy1) NM_172557 RUN and FYVE domain containing 1 Gene [Source:MGI (curated);Acc:Rufy1-001]


Sequence tag IST11409A10HMF1
Sequence
GGCTGCAGAAAATCCTCAGCGAGAAAGCTGTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4947381..4947413 33
NO GENE  

 
Come back to gene ENSMUSG00000020375


For any suggestions or comments, please send an email to unitrap@crg.es