Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10276E12
Clone ID IST10276E12
Vector VICTR76
Project tigm

Sequence tag IST10276E12HMF2
Sequence
GGTATAAGTAGATGCAGGGACCCTAGCCCCCAAGCCATACAACTTACGGTAGCCAGCGTTATTCACCACACAATCCAGGT
GACCAAATCGAGAGAGGGTCTCAGAAACCANAGTCTGAGGAGAGAAGAAAGAGCAGGTGATGAGCTGAGAGGTGACAGTA
GTCTTGGAAAAGCCAGTAGGCCCAAGGCAAGGATGGGCTCANCTGAGGAANACAAGGTGGAGCGAGGGGGAGAGGGGAGG
ATGCANGAAGCTGAGGACCCAGACTAAAAGAACTAAGGGACATAGTGCAGTTGCCGTTTGTCACAGCTAGTGTTTCTATC
ACTGTGATAAACACCATGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52812753..52813091 331
 
EST/CDNA Est Name
  AA409337.1


Sequence tag IST10276E12BBF1
Sequence
GGAGTGACTTANCTTTTACAATCTTGCTGAATTCTAAACCCTTGATCTTGGTCAAGGACACCCTTGGACTGTTGGAACAC
TGGCGGAAGACTTTAGCCATGTCAGAGCACTTATAGGAAAATACTGAAAGAGAGCACGTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI13393

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45592532..45592675 142
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023935 (Spats1) NP_081925 spermatogenesis associated, serine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1918270]

 
Come back to gene ENSMUSG00000023935


For any suggestions or comments, please send an email to unitrap@crg.es