Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13053D12
Clone ID IST13053D12
Vector VICTR76
Project tigm

Sequence tag IST13053D12HMF1
Sequence
GGTGATGAAGAGCAGTGTGGAAGTATAAGCTGAATAAACCCTTTCCTCCCCAACTTGCTTCTTGGTNNTGATGTGTGTGC
AGGAATAGAAACCCCGACTAAGACAGGTGATTTTTAGTTTGTTTGCNAAGTAGGTTGCAAAAATCATCATCTCCTTAGTT
GCANAGTATTTTCAGCATCCCACAAAAGACAGTCTCTTCACTCCTCTCTCAAGCATTTCTTAGTCGTTCATTTTCTTTGG
ATTTGATTATTCTGAATGTTTCATATAAATAGAACCCACTCGTATGGNCTTTGGCGTCNGGCTTCTTTCATTTGGCATGT
NNNTCANGATCATTTGTGTTTGACATAGAAAAATATTGCATTTGCCTTTGTGGGG
Sequence Type genomic DNA
Unitrap ID UNI2049

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4808327..4808700 354
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025903 (Lypla1) NM_008866 lysophospholipase 1 Gene [Source:MGI (curated);Acc:Lypla1-001]


Sequence tag IST13053D12BBF1
Sequence
GGTGATGAAGAGCAGTGTGGAAGTATAAGCTGAATAAACCCTTTCCTCCCCAACTTGCTTCTTGGTCATGATGTGTGTGC
AGGAATAGAAACCCCGACTAAGACAGGTGATTTTTAGTTTGTTTGCAAAGTAGGTTGCAAAAATCATCATCTCCTTAGTT
GCAGAGTATTTTCAGCATCCCACAAAAGACAGTCTCTTCACTCCTCTCTCAAGCATTTCTTAGTCGTTCATTTTCTTTGG
ATTTGATTATTCTGAATGTTTCATATAAATAGAACCCACTCGTATGGTCTTTGGCGTCGGGCTTCTTTCATTTGGCATGT
TTTTCANGATCATTTGTGTTTGACATANAAAAATATTGCNTTTGCCTTTGTGGGTGGCATGCATACACTCCAGTGTTAAG
ATACTCATGCCCATGTGGGACCNGAACAGGACACTGTGTCCTCCTCTATTGCACTCCATNNNANTGACTTNANAAANGTT
CTCTCACTGTNCTAC
Sequence Type genomic DNA
Unitrap ID UNI2049

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4808327..4808820 470
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025903 (Lypla1) NM_008866 lysophospholipase 1 Gene [Source:MGI (curated);Acc:Lypla1-001]


Sequence tag IST13053D12HMR1
Sequence
CACCAAGGAAGTCAGGACTGGAACTCAAGCAGGTCAGGAAGCAGGAGCTGATGCAGAAGCCATGGAGGGATGCTCTTTAC
TGGCTTGCCTCCCCTGGCTTGCTCAGCCTGCTCTCTTATAGAACCAAGATTACCAGCCCAGAGATGGCACCACCCACAAG
GGGCCTTTCCCCCTTGATCACTAATTGAGAAAATGCCTTACAGTTGGATCTCTTGGAGGCATTTACTCAACTGAAGCTCC
TTTCTCTGTAATAACTCCNGCTGTGTCNAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4808059..4808330 268
NO GENE  

 
Come back to gene ENSMUSG00000025903


For any suggestions or comments, please send an email to unitrap@crg.es