Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_341D1-3
Clone ID CMHD-GT_341D1-3
Vector pUPA
Project cmhd

Sequence tag CMHD-GT_341D1-3
Sequence
GCTGGACCACGCACGCGCAGACATTGAGAAGCAGATCCGCGCACGCGTGCGCCAGGTGGTAGACTACGTGCAGGCTCAGG
AGCGCGAGCTGCTCGAGGCGGTGAATGACCGCTACCAGCGCGACTACCAGGAAATAGCTGGCCAGCTGAGCTGCCTGGAA
GCTGTGCTGCAGCGCATCCGCACTAGTGGGGCGCTGGTCAAGAGGATGAAGCTCTATGCCTCCGACCAGGAGGTGCTGGA
TATGCACAGCTTTCTGCGCAAGGCACTCTGTAGCTTGCGCCAGGAGGAGCCCCAGAACCAGAAAGTCCAGCTGCTCACCA
GAGGTTTCGAGGAGTTCAAGCTGTGCCTGCAGGACTTCATCTCCTGCATCACCCAGAGGATAAATGCAGCTGTAGCCAGC
CCAGAGGGCAGCCAGCAATCAACCAGAGGCAG
Sequence Type mRNA
Unitrap ID UNI7564

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58081007..58082542 385
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036986 (Pml) NM_178087 promyelocytic leukemia Gene [Source:MGI Symbol;Acc:MGI:104662]

 
Come back to gene ENSMUSG00000036986


For any suggestions or comments, please send an email to unitrap@crg.es